miércoles, 19 de junio de 2013

Primeros quince días de vacaciones. Feria, Encuentro, catas, muchas cervezas y hasta un pediatra

Del tres al catorce del presente disfruté de mi primera quincena de vacaciones durante este año. Unos quince días que los esperaba con ansias como agua de mayo. Después de una dura última semana de trabajo por fín se hizo realidad y el viernes 31 de mayo por fin se hizo realidad a eso del mediodía.

El mismo viernes tocaba ir de viaje a Valladolid, a encontrarme con unos amigos los cuales íbamos a asistir el sábado por la mañana a la Feria de Cerveza Artesanal y Encuentro de Coleccionismo Cervecero de Medina (en breve tendré la entrada correspondiente).

De vuelta el domingo tocaba descanso y empezar a hacer la maleta para el martes irnos de viaje a La Mata (Alicante), unas de las muchas playas que posee Madrid, jejeje; previa visita al pediatra el lunes.

Y fue así como el martes a mediodía llegamos a la casa adosada que poseen mis suegros en La Mata. Había que hacer una breve compra pues comida para los críos llevabámos pero para nosotros poca cosa así es que me presenté voluntario entre las pocas opciones que había de ir al supermercado más cercano y comprar alguna cosa para salir del paso. Bueno, eso..., y ver qué cervezas había en un sitio dominado por el turismo británico, escandinavo y alemán. Allí fue donde me compré mis primeras cervezas: una London Porter de Fuller's que precisamente cayó el domingo mientras veía perder al Real Madrid de basket contra el FC Barcelona, un robo manifiesto; y una ESB Bitter en lata de 50cl. Pensé que con dos cervezas nuevas para mis papilas no me iba a conformar así es que me acordé que JORGE CERVERIANA me dijo que había un supermercado por la zona en donde se podían comprar cervezas inglesas. Lo demás fue fácil. Me puse en contacto con él. Me dijo cómo se llamaba, Iceland, me dirijí allí sin dudarlo mucho. Y me encontré con un buen arsenal de Bitter y Premium Bitter ESB de las islas británicas. Compré todas las que me faltaban por 'catar' y repetí con algunas que as recordaba bastante buenas. Esto es todo lo que compré esa tarde.

Un cameo de Birraire, aunque no sean las birrotes británicos que él se ha bebido en ciertos festivales...


Cerveceramente hablando quedaba lo más gordo. La visita del mismísimo Pau Lupuloadicto y su pareja Rosana. La quedada ya estaba coordinada días antes y tuvo lugar el miércoles 12. Los adictos a la Cannabácea llegaron a mediodía y tras unos trámites previos en los cuales nos dio tiempo a que cayera una Belhaven Best nos fuimos a comer a un clásico de la zona, la micro alemana deBassus. Allí probamos los tres tipos de cerveza que disponían: la Weizen, la Dunkel y la Hell; sólo faltaba la Pilsen que nos sirvió para tragar el riquísimo codillo que nos metimos entre pecho y espalda Pau y yo. Nuestras parejas optaron por otro menú más ligero. Quedamos verdaderamente maravillados por la deBassus Weizen, la cual era todo aroma, todo sabor y todo cuerpo. La deBassus Helles fue más ligera que su predecesora y la más floja de las tres. Por último la de Bassus Dunkel nos agradó en la justa medida, que aúnque no se acercaba a la calidad de la Weizen era bastante correcta.


Bonito interior de la deBassus.
Tras la comida vuelta a casa y comenzaba nuestra sesión maratoniana bebiendo cerveza que nos iba a tener ocupados hasta las 04:30 de la madrugada. Estas fueron las cervezas que fueron cayendo a lo largo del día:
  • Belhaven Best (50cl)
  • deBassus Weizen (33cl)
  • deBassus Helles (33cl)
  • deBassus Dunkel (33cl)
  • Sagra Bohío (75cl)
  • Domus Zircus Lime's Ale (75cl)
  • Brew Wharf / Marina Black Cat RyePA (50cl)
  • Son / La Pirata Mayo 15:37 (33cl)
  • Diabolici (75cl)
  • Boddingtong's Draught Bitter (50cl)
  • Greene King IPA Export (50cl)
  • Huvila X-Porter (50cl)
  • BFM Abbaye de Saint Bon Chien 2011 (37.5cl)
  • Panil Barriquée Sour (75cl)
  • El Oso y el Cuervo / Yria-Guinea Pigs! Estigia (33cl)
  • El Oso y el Cuervo / Yria-Guinea Pigs! Banshee Bragot (33cl)

La primera fue la Sagra Bohío que un servidor ya la había tomado en botella de 33cl. Tenía una disponible en casa de 75cl y como aún no la había probado Pau, qué mejor ocasión para abrirla. Si bien a mi persdonalmente la de 33cl me dejó ni fu ni fa esta lo que más me llamó la atención es que había ganado en aroma, por supuesto en sabor y con mucho más cuerpo. Una prueba más que dependiendo dónde se acondione la cerveza varía muchísimo dependiendo de un envase a otro (me refiero a capacidad). También ayudaría a ello a que la botella llevaría conmigo desde hace más o menos año y medio o más; de hecho me la compré recién sacaron esta cerveza la gente de Sagra. Me llevé una muy grata sorpresa y haciendo un balance de entre todas las que nos bebimos esta bien pudiera estar entre el Top 5.

Una gratísima sorpresa en 75cl

Después de las notas maltosas y torrefactas de la Bohío le tocó el turno a la Domus Zircus Lime's Ale. De la noche al día, como era de esperar... Una cerveza muy ligera en donde no faltaban las notas a levadura, el trigo y muy frutal con alto contenido en toques a lima y cáscara de limón con un final ligeramente amargo y seco. Una cerveza que por otro lado no nos convenció en cuanto a la relación calidad-precio., todo sea dicho.




Una no muy buena sorpresa


Después del pequeño chasco de la cerveza con lima había que probar algo más sabor. Nos decantamos por la Black Cat RyePA. Hay cerveza con posos y posos con cerveza, este último caso es esta cerveza. No nos convenció mucho y lo primero que nos llamó la atención son algunos de los lúpulos utilizados: Herkules, Kohatu, Galaxy. Ya en Madrid buscando acerca de ellos he de decir muy brevemente que el Herkules es originario de Alemania el cual confiere un gran amargor y aroma especiados; el Kohatu es originario de Nueva Zelanda, muy novedoso y el cual confiera notas a frutas tropicales; y el Galaxy, originario de Australia, muy novedoso también y el cual contribuye con buenas notas cítricas y tropicales.


Posos con cerveza, pero muy curiosa


Había que cambiar de escenario cuando el sol iba bajando por el horizonte y salimos al patio en donde seguíamos inmersos en nuestras cervezas acompañada de muy buenas conversaciones, que hasta ahora no lo he dicho... Festivales y ferias, breweriana y Ratebeer, catas y micros, blogueros y coleccionistas,..., los temas se iban enlanzando unos con otros sin darnos en cuenta que poco a poco iba atardeciendo. La siguiente cerveza fue otra colaboración, como la anterior, en este caso dos nacionales: Son y La Pirata; y la cerveza la Mayo 15:37. Una cerveza en el que el trigo, los toques cítricos y las levaduras están fuertemente presentes. En boca muy untuosa, mantecosa con un final ligeramente dulce y agradable a la vez que refrescante.


La Pirata y Son pocas veces defrauda

No podía faltar a la 'cata' una cerveza belga, y así es como descorchamos la Diavolici de la John Martin's. La típica Belgian Strong Ale, sí, es cierto, pero que a mi personalmente me supo a gloria, creo que por el tiempo que llevaba sin tomarme una cerveza de este estilo. Pero también y sobretodo por esas notas dulces, mantecosas, a galleta y a levadura belga con una alta presencia de malta. Muy buen final compensado, redonda y cremosa en paladar.


No podía faltar la levadura belga

Con esta cerveza llegamos a la hora de cenar, en la cual nos bebimos una Boddingtong's Draught Bitter y una Greene King IPA Export. Ambas cervezas normalitas dentro de su estilo. Por cierto, la Boddingtong's causó risas y miradas a raiz de esta entrada y por ver cómo subía la espuma después de servirla gracias al sistema Draught con su bolita interior de plástico.

Al terminar la cena y para terminar la velada había que continuar con las cervezas más fuertes en cuanto a graduación alcohólica. Así es como empezamos por la Baltic Porter Huvila X Porter de Finlandia. Otra de las cervezas que a la postre ocuparía el Top 3. De color negro, presencia densa, aroma a maltas asadas y ligeros toques a madera que se mantienen en boca y en donde aparecen las notas a café negro, regaliz, fruta madura y notas ahumadas.
Una finesa para calentar

La siguiente fue otra Top 3 y viniendo de Pau no podían faltar las cervezas sour. La primera fue una BFM Abbaye de Saint Bon-Chien 2011. Vaya descubrimiento por mi parte. Me quedé entre perplejo y estupefacto por la intensidad aromática de esta cerveza, a la vez que de toques ácidos, frutos rojos: grosellas y cerezas, ligeros toques a madera. Muy fresca, refrescante y bebible a la vez que altamente recomendable.

La mejor sour con diferencia hasta ahora

La siguiente sour fue la Panil Barriquée Sour. Si bien la anterior gozaba de un excelente aroma que se metía por todas las pituitarias esta se quedaba un poco corta en este aspecto. No obstante gozaba también de notas a madera y frutales predominando la manzana; a la vez de ácidos, pero como he dicho anteriormente en menos medida que la BFM.

La italiana que no terminó de convencer


No podian faltal las Imperial Stout y así es como llegamos a las tantas de la madrugada con una El Oso y el Cuervo / Yria-Guinea Pigs! Estigia. Una cerveza que obtuve gracias a haber participado en el crowdfunding..., o no..., no lo sé ahora realmente a raiz de la conversación que tuvo lugar en ese momento. La Estigia posee un intenso aroma a café, toques a madera, humo y ceniza. En boca aparecen las maltas chocolate con notas asadas, se intensifican aquellas a café negro y fruta madura. Por otro lado el final no lo encontré muy alcohólico a pesar de sus 8.2% ABV pero sí muy cremosa.


Una Impy no podía faltar

Para terminar quedaba la El Oso y el Cuervo / Yria-Guinea Pigs! Banshee Bragot. Sus 16% ABV la hacían idónea para terminar con la sesión e irse a la cama. Esta es la otra, aparte de la Quimera, conseguida gracias al crowdfunding..., o no..., como en el caso anterior tampoco estoy seguro. Este hidromiel, en este caso, nos pareció bastante engañoso. Si bien el aroma es embriagador con matices maltosos, dulces, caramelo, miel, alcohólico y notas a uva; en boca, concretamente en el paladar, pierde bastante. Mantiene las notas a maltas, frutales, uva; pero también se encuentran unas trazas 'a verde', como si no estuviera hecho del todo o no se haya terminado de hacer, un poco indeseable. Un tanto extraño. Dispongo de otra botella y esperaré un tiempo a ver si mejora, pero me da a mi que no lo va a hacer. Ya veremos.


...y otra que tampoco terminó de convencer...

Con el último trago de la Banshee Bragot nos dieron las 04:30 de la madrugada, sentados en dos sillas en el patio de la casa, 'al fresco' como diría un lugareño de cualquier pueblo de la geografía española, pero tocaba recojerse y descansar. A Pau y a Rosana, la cual se había acostado mucho antes, al igual que mi santa esposa, les esperaba el viaje de vuelta a casa.

A la mañana siguiente sólo tocaba hacer una foto de la escabechina realizada el día anterior. Lo que viene siendo la foto típica.

Faltan un par de latas de 50cl...

Y por supuesto la foto con Pau. Se ve que a lo largo de 14 horas bebiendo cerveza (desde las 14:00 del día anterior hasta las 04:30) no nos dío tiempo de hacernos ni que nos hagan una foto juntos. Y es que cuando de malta, agua, lúpulo y levadura se refiere todo pasa rapidísimo.

Un grande

Muchas gracias Pau por vuestra visita y por hacernos pasar un gran día juntos.


NOTA: esta entrada está dedicada a:
  • Por supuesto Pau y Rosana por visitarnos durante un día de nuestras vacaciones.
  • Joan Birraire, por el cameo en esta entrada, porque aunque no me pude pasar por su despedida de Madrid, espero que nos veamos pronto. Lo siento, me hubiera encantado asistir. Y por los buenos momentos que hemos pasado cuando nos hemos visto por la 'capi'.
  • Jorge cerveriana. Según tu comentario en la pasada entrada, ésta se te hizo corta. Toma esta para que te enteres...
  • A la conexión valenciana que me lleva de vez en cuando al huerto... que hay al lado de la parada del autobús.
  • A la conexión madrileña por pasar buenos momentos y que pasemos muchos más.
  • ...y qué demonios a todos los bloggers y lectores de este blog, si es que me lio me lio y al final...

10 comentarios:

  1. Canallas!!! No me avisastéis!!!!! Tampoco hubiera podido ir de todos modos.... menudas cervezas !!! Algunas las he probado y coincido en vuestros apuntes otras ni las probaré a este paso como las misteriosas 'crowfundidas'. Para mí la De Bassus Weizen también es la mejor de las que hacen allí y en eso coincide también nuestro colega Jorge... Gracias por la dedicatoria y a por la siguiente llevada al huerto... si hubieras subido a Valencia te hubieramos llevado a l'Horta y a otros sitios. Un abrazo cracks!!!

    ResponderEliminar
    Respuestas
    1. La verdad Txema es que aunque hubo varios e-mails de la quedada de por medio no le confirmé a Pau el día concreto hasta el mismo lunes de esa semana pues a lo mejor nos teníamos que volver para arreglar tema de colegio de los nenes. Para la próxima no te salvas.

      Las otras dos de crowdfunding me han dicho que las van a volver a elaborar, no te desanimes que seguro que tarde o temprano las pruebas. Si me entero que las sacan otra vez y te interesan dímelo y te las consigo

      Un abrazo Txema

      Eliminar
  2. Madre mía como os lo montáis algunos, menudo festival casero jeje

    Me ha llamado la atención lo que comentas de la Bohio. Yo la he probado de 33cl y como a ti, ni fu ni fa (de hecho me pareció cara para lo mediocre que es)...¿de verdad se nota esa diferencia en la de 75cl?

    La Zircus la tengo justamente ahora en la nevera. Sé que por 10€ no va a valer lo que cuesta, pero somos humanos y eso de edición limitada con lima sonaba demasiado bien jaja

    ¿La Black Cat Rye IPA no merece la pena entonces? La llevaba un tiempo queriendo comprar, porque siempre la tienen en Cervezorama y a mi el rollo centeno-lúpulo me gusta mucho, pero si no está muy allá...

    ¡La Mayo 15:37 me ha sorprendido mucho! la probé anoche y es una saison muy lograda, el toque del trigo y las especias le dan un toque muy curioso.

    La BFM esta tan famosa solo la he probado de barril. Me pareció muy curiosa, aunque tengo que decir que como todo lo sour aún me satura un poco al final.

    Las del crowfundin' aún no las he abierto, las tengo por ahí... lo de la hidromiel que comentas es una lástima, la tengo ganas. A ver si hay suerte y dejándola un tiempo mejora.

    El resto no las conocía, así que me ha servido para aumentar mi acervo cultural cervecero jeje me apuntaría alguna como la porter finlandesa, pero imagino que esas aquí serán imposibles de encontrar.

    ¡Un saludo!

    ResponderEliminar
    Respuestas
    1. No descansamos ni en vacaciones..., jajaja

      En serio lo de la Bohío. La encontré muchísimo mejor en 75cl que en 33cl.
      Nos pierde todo lo que suena 'Edición Limitada', 'Botella número ...'. Pero muchas veces hay que ir a lo seguro e irse a marcas con más... renombre.
      La Black Cat no me convenció a mi, que no digo que no valga la pena. Yo pienso que a toda cerveza hay que darla una oportunidad. Si te gusta la combinación centeno-lúpulo esta es la tuya sin duda. Quizás no era el momento más idóneo para probarla o mil cosas más..., incluso que estuviera infectada (que no era el caso).
      Coincidimos con la Mayo 15:37.
      LA BFM ha sido el gran descubrimiento. A mi me pasaba lo que a ti, quedaba saturado ante tanta acidez. Pero esta no ha sido el caso.
      Ánimo con las del crowdfunding. Me alegra saber que tu también las recibiste. No fui el único...

      la finlandesa la conseguí por medio de un intercambio. Aquí me temo que será imposible conseguirla, muy a mi pesar también.

      Un saludo.

      Eliminar
  3. ¡¡Pero qué tío más grande en todos los sentidos!! Cómo he disfrutado leyéndote! Brutal el post, desde el cameo a Birraire, a la visita a De Bassus (qué delicia de Weizen y de codillo!), por no hablar de todos los birrotes que cayeron en buena charla y al fresquito... Gratísimas sorpresas la Sagra de 75cl (me temo que mucho tiene que ver tu buen acondicionamiento), esa grandísima Huvila, la Pirata&Son y la BFM, entre otras. La pena fue Marina, esperaba más!

    En definitiva una grandísima velada con gente muy pero que muy grande: Eva, los dos peques y tú (bueno, y la gata, jeje!). Muchísimas gracias familia!

    ¡Un fuerte abrazo y hasta dentro de muy poco!

    P.D. Porque eres tú, porque eso de robo manifiesto en el primer partido... Ehem... jajajaja!! Total, habéis terminado ganando igualmente... ;)

    ResponderEliminar
    Respuestas
    1. Lo de Birraire no sé si os dísteis cuenta. Es de mis suegros y estaba en la habitación de al lado de donde durmísteis.

      A ver si coincidimos en otra..., si todo fructifica espero dentro de poco un intercambio con un noruego con algún petróleo que otro que no me gustaría tomar solo, jejeje

      Hemos llegado al quinto partido pero era por daros vidilla y por hacer caja en el pabellón... jajaja

      Eliminar
  4. Hola Jose

    lo cierto es que el braggot necesitaría un año para estar correcto.

    Ahora bien, tampoco garantizamos que vaya a mejorar tanto. Era un experimento arriesgado. Ojalá haya suerte y te equivoques.

    De cualquier manera repetiremos un braggot porque nos hemos quedado con ganas de que parta.

    Muchas gracias por la franqueza siempre

    ResponderEliminar
    Respuestas
    1. Hola, pues no hay problema en esperar todo lo que sea por abrirla. Tengo cervezas que aún llevan más tiempo...

      Dicen que el que arriesga no gana y vosotros mejore o no mejore esta cerveza ya me habéis ganado si tengo que elejir entre vuestras cervezas y otras.

      Un saludo.

      Eliminar
  5. GUAUUUUUUUGUAUUUUUUGAUUUUUUU, VAYA PEDAZO DE TROZO DE CACHO DE ENTRADA NENGGGGGGGG!!!!!
    JAJAJAJA, VAMOS A VER, POR ALUSIONES, EL TEMA DE LA CORTEDAD O NO DE TU ÚLTIMA ENTRADA NO LA HAS ENTENDIDO. ¿NO TE PASA A TI QUE CUANDO TE LO PASAS BIEN, EL TIEMPO PARA VOLADO? PUES A MI CON TU ANTERIOR POST ME PASÓ ESO, COMO LO DISFRUTABA, SE ME HIZO CORTO, NO DIGO QUE LO FUERA. ESO SI, ESTE LO HE DEVORADOOOOOOOO, JAJAJAJA. VAYA PAR DE.......¡GEMELAS! JIJIJI, VAYA CARITAS. CON LAS BIRRAS ABIERTAS Y CON LUZ DEL DIA, IMAGINO LOS TAMBORES EN VUESTRAS CABEZAS MIENTRAS OS HACÍAN LA FOTO, JAJAJAJA.
    DE LAS DE BASSUS COINCIDO CON VOSOTROS, LA HELLES PASA SIN PENA NI GLORIA, LA PILSEN NO VA MAL, PERO PARA VER UN PARTIDO. LA DUNKEL MEJORA Y LA WEIZEN ESTÁ MUY MUY BIEN, SIN LLEGAR A ESPECTACULAR, TAMPOCO OS PASEIS.
    LA BOHIO LA PROBÉ HACE MUCHO TIEMPO DE 75CL Y ME GUSTÓ BASTANTE. SERÁN LAS PRIMERAS QUE HICIERON O EL TAMAÑO, NO SE.
    LA ZIRCUS......AYYYYYY LA ZIRCUSSSSSSS, SE NOS ESTÁ YENDO DE LAS MANOS EL SNOBISMO PÁTRIO, ESOS PRECIACOS ULTIMAMENTE POR CERVEZAS NACIONALES EN BOTELLA GRANDEEEEEEEEE........AY DIOS MIO, DONDE VAMOS A LLEGAR.
    LA GREEN KING IPA ES UNA BAZOFIA, HABLEMOS CLARO Y LA BODDINGTON, PUES, CURIOSA, POR LA BOLITA JIJIJI, PERO NO DA PARA MUCHO MAS.
    LAS DE GUINEA YA DIJERON ( SI ES QUE NO HACEIS CASO Y VAIS A VUESTRA BOLA COJONES ) QUE SE GUARDARAN UN TIEMPO, SOBRE TODO LA BRAGGOT, POR LO QUE YO LAS DARÉ COBA HASTA EL OCTAVO FFDA MAS O MENOS, JAJAJAJA.
    LA MAYO ME LA MANDÓ UN AMIGO CORDOBÉS VIA CORREOS Y ME LA APRETÉ AL DIA SIGUIENTE ( LO DIGO POR LAS VUELTAS QUE DEBIÓ DAR Y LO QUE SE SACUDIÓ Y LA TEMPERATURA QUE SOPORTARÍA Y EL MAL VIAJE Y TAL Y TAL ) Y ESTABA MUYYYY BIEN, DENTRO DE LO QUE EL ESTILO SAISON ME DESCUADRA, HASTA AHORA ES LA QUE MAS ME HA GUSTADO, AUNQUE NO HABRÉ PROBADO MAS DE CINCO O SEIS CLARO.
    LA BLACK CAT RYE HA TENIDO MUY BUENAS CRÍTICAS, AUNQUE CREO QUE NO LA PILLÉ POR EL PRECIO ( AAAAYYYYYYYYYYYY YA ESTAAAAAMOOOOOOOOOS, LOS CERVECEROS DEBEMOS SER LOS NUEVOS RICOS MUCHACHO, AY QUE JODERSE )
    LA DIABOLICI....ES QUE TODAVÍA ESTOY ESPERANDO UNA JOHN MARTIN´S QUE ME GUSTE CHICO, NO ME OFRECEN GARANTÍAS Y NO SALEN BARATAS.
    DE PANIL SOLO HE PROBADO UNA Y NO VALIA PARA TOMAR POR SACO ( JODER COMO ESTOY HOY, PERDONAD TANTO TACO Y TANTA CRÍTICA ¡SAAAALLLL DE ESTE CUERPO, ABANDÓNAMEEEEE! UFF)
    Y ME QUEDO CON GANACAS DE LA BONCHIEN, SI DICES TU QUE MOLA, HABRÁ QUE BUSCARLA UN HUECO, AUNQUE CADA VEZ ESTOY MAS ESCALDADO DE LAS BIRRAS CARAS Y SI NO ME EQUIVOCO ESTA LO ES Y MUCHO ¿NO?
    PUES NADA, ME ALEGRO DE HABERTE VALIDO PARA ENCONTRAR ALGUNA INGLESILLA, AUNQUE NO ESTUVIERA LA MILD QUE ME APRETÉ EL AÑO PASADO EXQUISITA. HE VISTO QUE HAN TRAIDO LAS BLACK SHEEP ¿QUE TAL? ( POR SI VOY ESTE AÑO )
    UN SALUDO JOSHUA!!!

    ResponderEliminar
    Respuestas
    1. Jodo..., pues anda que el comentario. Creo que puede ser el más largo de la historia....

      Veo que coincidimos en bastantes. Opino lo mismo que tu sobre el precio de las nacionales en botella de 75cl. No sé a dónde vamos a llegar.
      Con respecto a las cervezas de la John Martin's... no te gusta o no has probado la Gordon Xmas???. POR DIOS!!! Creo que puede ser una de las mejores cervezas de navidad que he probado. Me encandiló en el Poechenenkelder y desde entonces todos los años me hago con alguna para diciembre para tomarla una y otra vez.

      No te puedo decir precio de la BFM. Fue aportación de Pau.

      En cuanto a las Black Sheep, pues no están mal pero no dejan de ser una Bitter o una Premium Bitter/ESB de las más usuales.

      Un saludo Yors

      Eliminar